Illumina

Sequencing Basics

Clusters: Groups of DNA strands positioned closely together. Each clustter represents thousands of copies of the same DNA fragment in a 1-2 micron spot
Flowcell: A thick glass slide with channels or lanes. Cluster generation and sequencing occur here. Each lane is randomly coated with a lawn of oligos that are complementary to library adapters.
- Random Flow cell
- Patterned Flow cell
Reads: The sequences of nucleotides (A, T, C, G) generated from the DNA fragments during sequencing.
Lanes: Individual channels on a flowcell that can be used for separate samples or experiments.
Indexing: Adding unique sequences (barcodes) to DNA fragments to identify different samples in a single sequencing run.
Adapters: Short DNA sequences attached to the ends of DNA fragments to facilitate binding to the flowcell and initiation of sequencing.
Paired-end sequencing: Sequencing both ends of a DNA fragment to provide more information and improve accuracy.
Coverage: The average number of times a nucleotide is read during sequencing, indicating the depth of sequencing.
Read length: The number of nucleotides in a single read generated by the sequencer.
Throughput: The total amount of data generated by a sequencing run, often measured in gigabases (Gb) or terabases (Tb).
Multiplexing: Combining multiple samples in a single sequencing run using unique indexes to save time and cost.
Demultiplexing: The process of separating mixed sequencing data back into individual samples based on their unique indexes.
Quality scores: Numerical values assigned to each nucleotide in a read, indicating the confidence in the accuracy of that base call.
Phred score: A specific type of quality score that represents the probability of an incorrect base call, commonly used in sequencing data analysis.
FASTQ format: A text-based file format that stores both nucleotide sequences and their corresponding quality scores.
BCL files: Binary files generated by Illumina sequencers that contain raw base call data and quality scores before conversion to FASTQ format.

Quality scores

Illumina uses Phred quality scores (Q scores) to represent the accuracy of each base call in sequencing data.
The Q score is calculated using the formula: Q = -10 log10(P), where P is the probability of an incorrect base call.
Higher Q scores indicate higher confidence in the accuracy of the base call.
For example:
- Q10: 90% accuracy (1 in 10 chance of error)
- Q20: 99% accuracy (1 in 100 chance of error)
- Q30: 99.9% accuracy (1 in 1000 chance of error)
- Q40: 99.99% accuracy (1 in 10,000 chance of error)
- Q50: 99.999% accuracy (1 in 100,000 chance of error)

The Mathematical Probability of Error

The Phred quality score (Q) is logarithmically related to the base-calling error probability (P). The formula is:

\[ Q = -10 \log_{10} P \]

When you have a Phred score of 10, the probability of a base being wrong is 1 in 10 (10%). When you move to Phred 11, that error rate drops to approximately 8%.

If a read has an average score of less than 11, it means that, statistically, at least one out of every ten bases in that read is likely incorrect. For a 100 bp read, you would expect 10 or more errors. 2. Impact on Alignment (Mapping)

Most aligners (like BWA, Bowtie2, or STAR) use these quality scores to calculate the “Mapping Quality.”

Misalignment: If a read is full of errors, the aligner might place it in the wrong part of the genome because the "wrong" bases happen to match a different location.

Low Mapping Scores: Even if the aligner finds the right spot, it will give the match a very low score. Downstream tools (like variant callers) often ignore reads with low mapping quality anyway.

Computational Waste: Processing thousands of "noisy" reads that will never align correctly takes up CPU time and memory without providing any biological insight.

Preventing False Positives in Variant Calling

This is especially critical for mutation detection or SNP calling.

If you are looking for a rare mutation (e.g., in cancer genomics), a 10% error rate is devastating.

The software won't be able to tell the difference between a real biological mutation and a sequencing error caused by the machine's inability to see the signal clearly.

The “Twilight Zone” of Sequencing

Scores below 11 or 12 are often referred to as being in the “twilight zone” of sequencing. At this level, the “signal-to-noise” ratio of the Illumina flow cell is so low that the base calls are essentially educated guesses.

Illumina Sequencing Libraries

The nature of Illumina sequencing is still sequencing by synthesis (SBS). Any SBS method requires the presence of adaptors, which are short double-stranded DNA oligos whose sequences are known to us. The adaptors are designed by scientists, and there are a few popular adaptor sequences that are used in the NGS field. The following three (actually two main types to be honest) are the most popular ones:

Truseq Single Index Library

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5                   Truseq Read 1                        Truseq Read 2                 i7        Illumina P7

Truseq Dual Index Library

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5               i5            Truseq Read 1                          Truseq Read 2                 i7        Illumina P7

Nextera Dual Index Library

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-insert-CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTC-insert-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
           Illumina P5              i5             Nextera Read 1                                Nextera Read 2        i7         Illumina P7

There are some other adaptors that can be used, but they either become obsolete or not used usually. If you are interested, you can check the Illumina adapter sequences document for full details. Basically, the nature of an Illumina library preparation is the process of adding those coloured adaptor sequences to both sides of the DNA of your interest, which is the “-insert-” bit in the above examples. All the commercial kits you buy for the library preparation do EXACTLY that, no matter where you buy them, no matter what you want to sequence. In addition, you can also mix different types of adaptors due to the reasons mentioned in the “Library sequencing” section below. For example, you can use Truseq Read 1 at the left hand side, and Nextera Read 2 at the right hand side. Or you can use Nextera Read 1 at the left hand side and Truseq Read 2 at the right hand side. It is totally fine but not recommended for beginners.

The “N”s in the above examples are the indices, or barcodes that discriminate different samples. The index at the right hand side is often called “i7”, or index1, which is the index in the P7 primer; the index at the left hand side is called “i5”, or index2, which is the index in the P5 primer. This is because the index “i7” is sequenced first before “i5” is sequenced.

Now, the mission is: how to add those adaptors? Well, this is where you can become creative. In A profusion of confusion in NGS methods naming, Hadfield and Retief mentioned over 300 NGS methods in their Enseqlopedia wiki. ALL of them do and ONLY do one thing: add those adaptors to the sides of the DNA they want to sequence. Then, what is the difference among all those methods? They differ from how they add those adaptors.

Another important detail is that we should know the only required sequences are the following two:

Illumina P5 adaptor: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'
Illumina P7 adaptor: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

If you use Illumina sequencing, you have to use and make sure they are at the sides of your DNA fragments, like shown in the three examples above. The adaptor sequences in the middle like Truseq Read 1, Truseq Read 2, Nextera Read 1 and Nextera Read 2 can be changed. If you change them, you have to add your own sequencing primers to the machine during sequencing. A few single cell genomic methods used their own adaptors.

Library sequencing

Once those adaptors are added properly, we are ready to sequence them using Illumina machines. In the sequencing reagents provided by Illumina, the sequencing primers are actually a mixture of different primers, including Truseq, Nextera and even those primers from kits that are obsolete. Therefore, you actually can sequence different types of libraries together. For example, Truseq libraries and Nextera libraries can be mixed together and sequenced together without any problem. There are some slight differences among different Illumina machines, in terms of how they sequence Read 1, Read 2, Index 1 and Index 2.

Step 1: Add Read 1 sequencing primer mixture to sequence the first read (bottom strand as template)

Truseq Single Index Library:

                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT---->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Truseq Dual Index Library:

                                     5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT---->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Nextera Dual Index Library:

                                     5'- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG------>
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTC-insert-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Step 2: Add Index 1 sequencing primer mixture to sequence the first index (index 1, i7, bottom strand as template)

Truseq Single Index Library:

                                                                               5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Truseq Dual Index Library:

                                                                                         5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Nextera Dual Index Library:

                                                                                        5'- CTGTCTCTTATACACATCTCCGAGCCCACGAGAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTC-insert-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Step 3 (MiSeq, HiSeq 2000/2500, MiniSeq Rapid and NovaSeq 6000 v1.0): Folds over and sequence the second index (index 2, i5, bottom strand as template)

Truseq Single Index Library (not really needed):

5'- AATGATACGGCGACCACCGAGATCTACAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Truseq Dual Index Library:

5'- AATGATACGGCGACCACCGAGATCTACAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Nextera Dual Index Library:

5'- AATGATACGGCGACCACCGAGATCTACAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTC-insert-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Step 3 (iSeq 100, MiniSeq Standard, NextSeq, HiSeq X, HiSeq 3000/4000 and NovaSeq 6000 v1.5): Add Index 2 sequencing primer mixture to sequence the second index (index 2, i5, top strand as template)

Truseq Single Index Library:

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                     <-------TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA -5'

Truseq Dual Index Library:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                 <-------TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA -5'

Nextera Dual Index Library:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-insert-CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                 <-------AGCAGCCGTCGCAGTCTACACATATTCTCTGTC -5'

Step 4: Cluster regeneration, add Read 2 sequencing primer mixture to sequence the second read (top strand as template)

Truseq Single Index Library:

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                            <------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

Truseq Dual Index Library:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                  <------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

Nextera Dual Index Library:

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-insert-CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                                         <------GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG -5'

Illumina 5-base

Map: Align reads to the reference.
Call: Decide if a “T” is a 5th base (5mC) or a mutation.
Overlay: Compare those sites to a database of known genes and CpG islands.
Compare: Look for differences between samples to find “Biological Hits.”

--- title: Illumina date: 2026-01-01 published-title: Created date-modified: last-modified title-block-banner: "#212529" # toc: true # toc-location: left toc-title: "Contents" execute: eval: false format: html: code-tools: source: true toggle: true css: illumina.css --- ## Sequencing Basics ![](illumina_barcode.png){width=600px} - Clusters: Groups of DNA strands positioned closely together. Each clustter represents thousands of copies of the same DNA fragment in a 1-2 micron spot - Flowcell: A thick glass slide with channels or lanes. Cluster generation and sequencing occur here. Each lane is randomly coated with a lawn of oligos that are complementary to library adapters. - Random Flow cell - Patterned Flow cell - Reads: The sequences of nucleotides (A, T, C, G) generated from the DNA fragments during sequencing. - Lanes: Individual channels on a flowcell that can be used for separate samples or experiments. - Indexing: Adding unique sequences (barcodes) to DNA fragments to identify different samples in a single sequencing run. - Adapters: Short DNA sequences attached to the ends of DNA fragments to facilitate binding to the flowcell and initiation of sequencing. - Paired-end sequencing: Sequencing both ends of a DNA fragment to provide more information and improve accuracy. - Coverage: The average number of times a nucleotide is read during sequencing, indicating the depth of sequencing. - Read length: The number of nucleotides in a single read generated by the sequencer. - Throughput: The total amount of data generated by a sequencing run, often measured in gigabases (Gb) or terabases (Tb). - Multiplexing: Combining multiple samples in a single sequencing run using unique indexes to save time and cost. - Demultiplexing: The process of separating mixed sequencing data back into individual samples based on their unique indexes. - Quality scores: Numerical values assigned to each nucleotide in a read, indicating the confidence in the accuracy of that base call. - Phred score: A specific type of quality score that represents the probability of an incorrect base call, commonly used in sequencing data analysis. - FASTQ format: A text-based file format that stores both nucleotide sequences and their corresponding quality scores. - BCL files: Binary files generated by Illumina sequencers that contain raw base call data and quality scores before conversion to FASTQ format. ## Quality scores - Illumina uses Phred quality scores (Q scores) to represent the accuracy of each base call in sequencing data. - The Q score is calculated using the formula: Q = -10 log10(P), where P is the probability of an incorrect base call. - Higher Q scores indicate higher confidence in the accuracy of the base call. - For example: - Q10: 90% accuracy (1 in 10 chance of error) - Q20: 99% accuracy (1 in 100 chance of error) - Q30: 99.9% accuracy (1 in 1000 chance of error) - Q40: 99.99% accuracy (1 in 10,000 chance of error) - Q50: 99.999% accuracy (1 in 100,000 chance of error) 1. The Mathematical Probability of Error The Phred quality score (Q) is logarithmically related to the base-calling error probability (P). The formula is: $$ Q = -10 \log_{10} P $$ When you have a Phred score of 10, the probability of a base being wrong is 1 in 10 (10%). When you move to Phred 11, that error rate drops to approximately 8%. If a read has an average score of less than 11, it means that, statistically, at least one out of every ten bases in that read is likely incorrect. For a 100 bp read, you would expect 10 or more errors. 2. Impact on Alignment (Mapping) Most aligners (like BWA, Bowtie2, or STAR) use these quality scores to calculate the "Mapping Quality." Misalignment: If a read is full of errors, the aligner might place it in the wrong part of the genome because the "wrong" bases happen to match a different location. Low Mapping Scores: Even if the aligner finds the right spot, it will give the match a very low score. Downstream tools (like variant callers) often ignore reads with low mapping quality anyway. Computational Waste: Processing thousands of "noisy" reads that will never align correctly takes up CPU time and memory without providing any biological insight. 3. Preventing False Positives in Variant Calling This is especially critical for mutation detection or SNP calling. If you are looking for a rare mutation (e.g., in cancer genomics), a 10% error rate is devastating. The software won't be able to tell the difference between a real biological mutation and a sequencing error caused by the machine's inability to see the signal clearly. 4. The "Twilight Zone" of Sequencing Scores below 11 or 12 are often referred to as being in the "twilight zone" of sequencing. At this level, the "signal-to-noise" ratio of the Illumina flow cell is so low that the base calls are essentially educated guesses. ## Illumina Sequencing Libraries The nature of Illumina sequencing is still sequencing by synthesis (SBS). Any SBS method requires the presence of adaptors, which are short double-stranded DNA oligos whose sequences are known to us. The adaptors are designed by scientists, and there are a few popular adaptor sequences that are used in the NGS field. The following three (actually two main types to be honest) are the most popular ones: ### Truseq Single Index Library <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><s5>TCTTTCCCTACACGACGCTCTTCCGATCT</s5>-insert-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><s5>AGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' <p5>Illumina P5</p5> <s5>Truseq Read 1</s5> <s7>Truseq Read 2</s7> <t7>i7</t7> <p7>Illumina P7</p7> </pre> ### Truseq Dual Index Library <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><t7>NNNNNNNN</t7><s5>ACACTCTTTCCCTACACGACGCTCTTCCGATCT</s5>-insert-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><s5>TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' <p5>Illumina P5</p5> <t7>i5</t7> <s5>Truseq Read 1</s5> <s7>Truseq Read 2</s7> <t7>i7</t7> <p7>Illumina P7</p7> </pre> ### Nextera Dual Index Library <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><t7>NNNNNNNN</t7><r1>TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG</r1>-insert-<r2>CTGTCTCTTATACACATCTCCGAGCCCACGAGAC</r2><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><r1>AGCAGCCGTCGCAGTCTACACATATTCTCTGTC</r1>-insert-<r2>GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG</r2><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' <p5>Illumina P5</p5> <t7>i5</t7> <r1>Nextera Read 1</r1> <r2>Nextera Read 2</r2> <t7>i7</t7> <p7>Illumina P7</p7> </pre> There are some other adaptors that can be used, but they either become obsolete or not used usually. If you are interested, you can check the Illumina adapter sequences document for full details. Basically, the nature of an Illumina library preparation is the process of adding those coloured adaptor sequences to both sides of the DNA of your interest, which is the "-insert-" bit in the above examples. All the commercial kits you buy for the library preparation do EXACTLY that, no matter where you buy them, no matter what you want to sequence. In addition, you can also mix different types of adaptors due to the reasons mentioned in the "Library sequencing" section below. For example, you can use Truseq Read 1 at the left hand side, and Nextera Read 2 at the right hand side. Or you can use Nextera Read 1 at the left hand side and Truseq Read 2 at the right hand side. It is totally fine but not recommended for beginners. The "N"s in the above examples are the indices, or barcodes that discriminate different samples. The index at the right hand side is often called "i7", or index1, which is the index in the P7 primer; the index at the left hand side is called "i5", or index2, which is the index in the P5 primer. This is because the index "i7" is sequenced first before "i5" is sequenced. Now, the mission is: how to add those adaptors? Well, this is where you can become creative. In [A profusion of confusion in NGS methods naming](https://www.nature.com/articles/nmeth.4558/), Hadfield and Retief mentioned over 300 NGS methods in their [Enseqlopedia wiki](http://www.enseqlopedia.com/enseqlopedia). ALL of them do and ONLY do one thing: add those adaptors to the sides of the DNA they want to sequence. Then, what is the difference among all those methods? They differ from how they add those adaptors. Another important detail is that we should know the only required sequences are the following two: <pre class="seq"> Illumina P5 adaptor: 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5> -3' Illumina P7 adaptor: 5'- <p7>CAAGCAGAAGACGGCATACGAGAT</p7> -3' </pre> If you use Illumina sequencing, you have to use and make sure they are at the sides of your DNA fragments, like shown in the three examples above. The adaptor sequences in the middle like Truseq Read 1, Truseq Read 2, Nextera Read 1 and Nextera Read 2 can be changed. If you change them, you have to add your own sequencing primers to the machine during sequencing. A few single cell genomic methods used their own adaptors. ### Library sequencing Once those adaptors are added properly, we are ready to sequence them using Illumina machines. In the sequencing reagents provided by Illumina, the sequencing primers are actually a mixture of different primers, including Truseq, Nextera and even those primers from kits that are obsolete. Therefore, you actually can sequence different types of libraries together. For example, Truseq libraries and Nextera libraries can be mixed together and sequenced together without any problem. There are some slight differences among different Illumina machines, in terms of how they sequence Read 1, Read 2, Index 1 and Index 2. * Step 1: Add Read 1 sequencing primer mixture to sequence the first read (bottom strand as template) **Truseq Single Index Library:** <pre class="seq"> 5'- <s5>ACACTCTTTCCCTACACGACGCTCTTCCGATCT</s5>----> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><s5>AGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> **Truseq Dual Index Library:** <pre class="seq"> 5'- <s5>ACACTCTTTCCCTACACGACGCTCTTCCGATCT</s5>----> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><s5>TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> **Nextera Dual Index Library:** <pre class="seq"> 5'- <r1>TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG</r1>------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><r1>AGCAGCCGTCGCAGTCTACACATATTCTCTGTC</r1>-insert-<r2>GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG</r2><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> * Step 2: Add Index 1 sequencing primer mixture to sequence the first index (index 1, i7, bottom strand as template) **Truseq Single Index Library:** <pre class="seq"> 5'- <s7>GATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7>-------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><s5>AGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> **Truseq Dual Index Library:** <pre class="seq"> 5'- <s7>GATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7>-------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><s5>TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> **Nextera Dual Index Library:** <pre class="seq"> 5'- <r2>CTGTCTCTTATACACATCTCCGAGCCCACGAGAC</r2>-------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><r1>AGCAGCCGTCGCAGTCTACACATATTCTCTGTC</r1>-insert-<r2>GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG</r2><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> * Step 3 (MiSeq, HiSeq 2000/2500, MiniSeq Rapid and NovaSeq 6000 v1.0): Folds over and sequence the second index (index 2, i5, bottom strand as template) **Truseq Single Index Library (not really needed):** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5>-------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><s5>AGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> **Truseq Dual Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5>-------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><s5>TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5>-insert-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> **Nextera Dual Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5>-------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><t7>NNNNNNNN</t7><r1>AGCAGCCGTCGCAGTCTACACATATTCTCTGTC</r1>-insert-<r2>GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG</r2><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> * Step 3 (iSeq 100, MiniSeq Standard, NextSeq, HiSeq X, HiSeq 3000/4000 and NovaSeq 6000 v1.5): Add Index 2 sequencing primer mixture to sequence the second index (index 2, i5, top strand as template) **Truseq Single Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><s5>TCTTTCCCTACACGACGCTCTTCCGATCT</s5>-insert-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' <-------<s5>TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5> -5' </pre> **Truseq Dual Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><t7>NNNNNNNN</t7><s5>ACACTCTTTCCCTACACGACGCTCTTCCGATCT</s5>-insert-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' <-------<s5>TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5> -5' </pre> **Nextera Dual Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><t7>NNNNNNNN</t7><r1>TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG</r1>-insert-<r2>CTGTCTCTTATACACATCTCCGAGCCCACGAGAC</r2><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' <-------<r1>AGCAGCCGTCGCAGTCTACACATATTCTCTGTC</r1> -5' </pre> * Step 4: Cluster regeneration, add Read 2 sequencing primer mixture to sequence the second read (top strand as template) **Truseq Single Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><s5>TCTTTCCCTACACGACGCTCTTCCGATCT</s5>-insert-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' <------<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7> -5' </pre> **Truseq Dual Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><t7>NNNNNNNN</t7><s5>ACACTCTTTCCCTACACGACGCTCTTCCGATCT</s5>-insert-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' <------<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7> -5' </pre> **Nextera Dual Index Library:** <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><t7>NNNNNNNN</t7><r1>TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG</r1>-insert-<r2>CTGTCTCTTATACACATCTCCGAGCCCACGAGAC</r2><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' <------<r2>GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTG</r2> -5' </pre> ## Illumina 5-base 1. Map: Align reads to the reference. 2. Call: Decide if a "T" is a 5th base (5mC) or a mutation. 3. Overlay: Compare those sites to a database of known genes and CpG islands. 4. Compare: Look for differences between samples to find "Biological Hits."