Visium v2 (WT Panel, CytAssist)

Visium v2 introduces probe-based Whole Transcriptome (WT) Panel chemistry and requires the CytAssist instrument. Unlike the v1 poly-T capture approach, v2 uses pre-designed probe pairs that hybridise to specific transcripts. This makes it compatible with FFPE, fresh-frozen, and fixed-frozen tissues — including degraded RNA samples where the v1 poly-T capture would fail.

Key differences from v1:

Feature	Visium v1	Visium v2 (WT Panel)
RNA capture	poly-T (whole transcriptome)	probe pairs (WT Panel ~18,000 genes)
Sample compatibility	Fresh-frozen only	FFPE, FF, Fixed-frozen
CytAssist required	No	Yes
Slide architecture	Direct tissue permeabilisation	Standard glass → CytAssist transfer
Spots	5,000 (55 µm)	5,000 (55 µm)

The CytAssist instrument transfers the hybridised probe-ligation products from a standard glass slide onto the Visium capture area, enabling a standard histological workflow for tissue preparation.

Assay Principle

Tissue section is placed on a standard glass slide and processed histologically (H&E or IF staining).
Probe pairs hybridise to target mRNAs in the tissue; ligase joins LP + RP to form Probe-Ligation Products (PLPs).
The CytAssist instrument transfers PLPs from the glass slide to the Visium capture area.
On the capture area, PLPs are captured by surface-bound poly-T oligos containing the spatial barcode + UMI.
Template switching synthesis through the PLP creates the spatial-barcoded cDNA.
Library preparation follows the standard TruSeq workflow.

Capture Spot Oligonucleotide

5'- CTACACGACGCTCTTCCGATCT[16-bp spatial BC][12-bp UMI](T)30VN -3'    (surface-bound on Visium slide)

Adapter and Primer Sequences

Left Probe (LP) ligation handle: 5'- [target-specific]AGATCGGAAGAGCGTCGT -3'

Right Probe (RP) 5′ end: 5'- [probe-specific linker][target-specific] -3' (5′ phosphorylated for ligation)

Capture spot oligo:

5'- CTACACGACGCTCTTCCGATCT[16-bp spatial BC][12-bp UMI](T)30VN -3'

TSO:

5'- AAGCAGTGGTATCAACGCAGAGTACATGGGRGG -3'

TruSeq Read 1 primer: 5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'

TruSeq Read 2 primer: 5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'

TruSeq adapter (dsDNA, T overhang):

5'-  GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'
3'- TCTAGCCTTCTCG -5'

Library PCR primer 1: 5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC -3'

Library PCR primer 2: 5'- CAAGCAGAAGACGGCATACGAGAT[8-bp sample index]GTGACTGGAGTTCAGACGTGT -3'

Illumina P5: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

Illumina P7: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Step-by-Step Library Generation

Step 1 — Tissue section preparation and probe hybridisation

Tissue section is placed on a standard glass slide. After staining and imaging, the section is permeabilised and WT Panel probe pairs hybridise to target mRNAs in situ.

mRNA  5'--XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX--3'
                 |||||||||||||||||||   |||||||||||||||||||
            [LP target-specific]  [probe BC][RP target-specific]

Step 2 — Probe ligation

Ligase joins LP and RP at their adjacent ends on the mRNA template, forming full-length PLPs. Unligated probes are removed.

5'- [LP adaptor][LP target][probe BC][RP target][RP capture handle] -3'   (PLP)

Step 3 — CytAssist transfer to Visium slide

The CytAssist instrument uses fluorescence to locate and transfer PLPs from the glass slide to the capture area of the Visium v2 slide.

Step 4 — PLP capture on spatial barcoded spot

The 3′ capture handle on the PLP (poly-A / complementary to poly-T) anneals to the poly-T portion of the capture spot oligo.

slide 5'- CTACACGACGCTCTTCCGATCT[spatial BC][UMI](T)30VN -3'
                                                          |||||||||||
                                      3'- [RP target][probe BC][LP target][LP adaptor] -5'  (PLP)

Step 5 — Extension through PLP (spatial barcode incorporation)

The spot oligo is extended through the full PLP using the PLP as template. This incorporates the spatial barcode and UMI into a cDNA representing the probe-ligated transcript.

slide 5'- CTACACGACGCTCTTCCGATCT[spatial BC][UMI](dT)VN[RP target][probe BC][LP target][LP adaptor complement] -3'

Step 6 — cDNA release and amplification

Extended product is released from the slide and PCR amplified:

   5'- CTACACGACGCTCTTCCGATCT-------->
5'- CTACACGACGCTCTTCCGATCT[spatial BC][UMI](dT)VN-PLP-[LP adaptor] -3'
3'- GATGTGCTGCGAGAAGGCTAGA[spatial BC][UMI](pA)B-PLP-[LP adaptor] -5'
                                              <---------[LP adaptor complement] -5'

Step 7 — Fragmentase, A-tailing, TruSeq adapter ligation, library PCR

Same as Visium v1 (Steps 5–7). The amplifiable product contains TruSeq Read 1 + spatial BC + UMI + PLP sequence, then TruSeq adapter + sample index + P7.

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-------->
          5'- CTACACGACGCTCTTCCGATCT[spatial BC][UMI]-PLP-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3'
          3'- GATGTGCTGCGAGAAGGCTAGA[spatial BC][UMI]-PLP-TCTAGCCTTCTCG                         -5'
                                                  <--------TGTGCAGACTTGAGGTCAGTG[8-bp idx]TAGAGCATACGGCAGAAGACGAAC -5'

Final Library Structure

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN-PLP-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN-PLP-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
          Illumina P5                   TruSeq Read 1              16 bp spatial BC  12 bp UMI   probe-ligation product      TruSeq Read 2          8 bp idx       Illumina P7

Library Sequencing

Step 1 — Read 1: spatial barcode + UMI (bottom strand as template)

                         5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT------------------------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN-PLP-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

28 cycles (16 bp spatial BC + 12 bp UMI).

Step 2 — Index 1 (i7): sample index (bottom strand as template)

                                                                               5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN-PLP-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

8 cycles.

Step 3 — Read 2: PLP / transcript sequence (top strand as template)

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNN-PLP-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                                        <------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

50+ cycles (PLP sequence contains probe barcode used for gene identification).

Key Points

Read 1 (28 cycles): 16 bp spatial barcode + 12 bp UMI.
Read 2 (50+ cycles): PLP including probe barcode — Space Ranger matches this to the WT Panel probe list.
The WT Panel covers ~18,000 human or mouse protein-coding genes.
CytAssist enables standard glass-slide histology before Visium capture — tissue sections can be H&E or IF stained and imaged before probe capture.
Compatible with FFPE, fresh-frozen, and fixed-frozen tissues.

--- title: "Visium v2 (WT Panel, CytAssist)" date: 2026-01-01 published-title: Created date-modified: last-modified title-block-banner: "#212529" toc: true toc-location: left toc-title: "Contents" execute: eval: false format: html: code-tools: source: true toggle: true css: 10x.css --- Visium v2 introduces **probe-based Whole Transcriptome (WT) Panel** chemistry and requires the **CytAssist** instrument. Unlike the v1 poly-T capture approach, v2 uses pre-designed probe pairs that hybridise to specific transcripts. This makes it compatible with **FFPE**, **fresh-frozen**, and **fixed-frozen** tissues — including degraded RNA samples where the v1 poly-T capture would fail. Key differences from v1: | Feature | Visium v1 | Visium v2 (WT Panel) | |---------|-----------|----------------------| | RNA capture | poly-T (whole transcriptome) | probe pairs (WT Panel ~18,000 genes) | | Sample compatibility | Fresh-frozen only | FFPE, FF, Fixed-frozen | | CytAssist required | No | Yes | | Slide architecture | Direct tissue permeabilisation | Standard glass → CytAssist transfer | | Spots | 5,000 (55 µm) | 5,000 (55 µm) | The CytAssist instrument transfers the hybridised probe-ligation products from a standard glass slide onto the Visium capture area, enabling a standard histological workflow for tissue preparation. --- ## Assay Principle 1. Tissue section is placed on a standard glass slide and processed histologically (H&E or IF staining). 2. Probe pairs hybridise to target mRNAs in the tissue; ligase joins LP + RP to form Probe-Ligation Products (PLPs). 3. The **CytAssist** instrument transfers PLPs from the glass slide to the Visium capture area. 4. On the capture area, PLPs are captured by surface-bound poly-T oligos containing the spatial barcode + UMI. 5. Template switching synthesis through the PLP creates the spatial-barcoded cDNA. 6. Library preparation follows the standard TruSeq workflow. --- ## Capture Spot Oligonucleotide <pre class="seq"> 5'- <s5>CTACACGACGCTCTTCCGATCT</s5><sbc>[16-bp spatial BC]</sbc><umi>[12-bp UMI]</umi>(T)30VN -3' (surface-bound on Visium slide) </pre> --- ## Adapter and Primer Sequences **Left Probe (LP) ligation handle:** `5'- [target-specific]AGATCGGAAGAGCGTCGT -3'` **Right Probe (RP) 5′ end:** `5'- [probe-specific linker][target-specific] -3'` *(5′ phosphorylated for ligation)* **Capture spot oligo:** ``` 5'- CTACACGACGCTCTTCCGATCT[16-bp spatial BC][12-bp UMI](T)30VN -3' ``` **TSO:** ``` 5'- AAGCAGTGGTATCAACGCAGAGTACATGGGRGG -3' ``` **TruSeq Read 1 primer:** `5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3'` **TruSeq Read 2 primer:** `5'- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT -3'` **TruSeq adapter (dsDNA, T overhang):** ``` 5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -3' 3'- TCTAGCCTTCTCG -5' ``` **Library PCR primer 1:** `5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC -3'` **Library PCR primer 2:** `5'- CAAGCAGAAGACGGCATACGAGAT[8-bp sample index]GTGACTGGAGTTCAGACGTGT -3'` **Illumina P5:** `5'- AATGATACGGCGACCACCGAGATCTACAC -3'` **Illumina P7:** `5'- CAAGCAGAAGACGGCATACGAGAT -3'` --- ## Step-by-Step Library Generation ### Step 1 — Tissue section preparation and probe hybridisation Tissue section is placed on a standard glass slide. After staining and imaging, the section is permeabilised and WT Panel probe pairs hybridise to target mRNAs in situ. <pre class="seq"> mRNA 5'--XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX--3' ||||||||||||||||||| ||||||||||||||||||| <lh>[LP target-specific]</lh> <probe>[probe BC]</probe><lh>[RP target-specific]</lh> </pre> ### Step 2 — Probe ligation Ligase joins LP and RP at their adjacent ends on the mRNA template, forming full-length PLPs. Unligated probes are removed. <pre class="seq"> 5'- <lh>[LP adaptor]</lh><lh>[LP target]</lh><probe>[probe BC]</probe><lh>[RP target]</lh><lh>[RP capture handle]</lh> -3' (PLP) </pre> ### Step 3 — CytAssist transfer to Visium slide The CytAssist instrument uses fluorescence to locate and transfer PLPs from the glass slide to the capture area of the Visium v2 slide. ### Step 4 — PLP capture on spatial barcoded spot The 3′ capture handle on the PLP (poly-A / complementary to poly-T) anneals to the poly-T portion of the capture spot oligo. <pre class="seq"> slide 5'- <s5>CTACACGACGCTCTTCCGATCT</s5><sbc>[spatial BC]</sbc><umi>[UMI]</umi>(T)30VN -3' ||||||||||| 3'- <lh>[RP target]</lh><probe>[probe BC]</probe><lh>[LP target]</lh><lh>[LP adaptor]</lh> -5' (PLP) </pre> ### Step 5 — Extension through PLP (spatial barcode incorporation) The spot oligo is extended through the full PLP using the PLP as template. This incorporates the spatial barcode and UMI into a cDNA representing the probe-ligated transcript. <pre class="seq"> slide 5'- <s5>CTACACGACGCTCTTCCGATCT</s5><sbc>[spatial BC]</sbc><umi>[UMI]</umi>(dT)VN<lh>[RP target]</lh><probe>[probe BC]</probe><lh>[LP target]</lh><lh>[LP adaptor complement]</lh> -3' </pre> ### Step 6 — cDNA release and amplification Extended product is released from the slide and PCR amplified: <pre class="seq"> 5'- <s5>CTACACGACGCTCTTCCGATCT</s5>--------> 5'- <s5>CTACACGACGCTCTTCCGATCT</s5><sbc>[spatial BC]</sbc><umi>[UMI]</umi>(dT)VN-<probe>PLP</probe>-<lh>[LP adaptor]</lh> -3' 3'- <s5>GATGTGCTGCGAGAAGGCTAGA</s5><sbc>[spatial BC]</sbc><umi>[UMI]</umi>(pA)B-<probe>PLP</probe>-<lh>[LP adaptor]</lh> -5' <---------<lh>[LP adaptor complement]</lh> -5' </pre> ### Step 7 — Fragmentase, A-tailing, TruSeq adapter ligation, library PCR Same as Visium v1 (Steps 5–7). The amplifiable product contains TruSeq Read 1 + spatial BC + UMI + PLP sequence, then TruSeq adapter + sample index + P7. <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><s5>TCTTTCCCTACACGACGCTC</s5>--------> 5'- <s5>CTACACGACGCTCTTCCGATCT</s5><sbc>[spatial BC]</sbc><umi>[UMI]</umi>-PLP-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7> -3' 3'- <s5>GATGTGCTGCGAGAAGGCTAGA</s5><sbc>[spatial BC]</sbc><umi>[UMI]</umi>-PLP-<s7>TCTAGCCTTCTCG</s7> -5' <--------<s7>TGTGCAGACTTGAGGTCAGTG</s7><t7>[8-bp idx]</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> --- ## Final Library Structure <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><s5>TCTTTCCCTACACGACGCTCTTCCGATCT</s5><sbc>NNNNNNNNNNNNNNNN</sbc><umi>NNNNNNNNNNNN</umi>-<probe>PLP</probe>-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><s5>AGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5><sbc>NNNNNNNNNNNNNNNN</sbc><umi>NNNNNNNNNNNN</umi>-<probe>PLP</probe>-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' <p5>Illumina P5</p5> <s5>TruSeq Read 1</s5> <sbc>16 bp spatial BC</sbc> <umi>12 bp UMI</umi> <probe>probe-ligation product</probe> <s7>TruSeq Read 2</s7> <t7>8 bp idx</t7> <p7>Illumina P7</p7> </pre> --- ## Library Sequencing ### Step 1 — Read 1: spatial barcode + UMI (bottom strand as template) <pre class="seq"> 5'- <s5>ACACTCTTTCCCTACACGACGCTCTTCCGATCT</s5>-------------------------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><s5>AGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5><sbc>NNNNNNNNNNNNNNNN</sbc><umi>NNNNNNNNNNNN</umi>-<probe>PLP</probe>-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> 28 cycles (16 bp spatial BC + 12 bp UMI). ### Step 2 — Index 1 (i7): sample index (bottom strand as template) <pre class="seq"> 5'- <s7>GATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7>-------> 3'- <p5>TTACTATGCCGCTGGTGGCTCTAGATGTG</p5><s5>AGAAAGGGATGTGCTGCGAGAAGGCTAGA</s5><sbc>NNNNNNNNNNNNNNNN</sbc><umi>NNNNNNNNNNNN</umi>-<probe>PLP</probe>-<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7><t7>NNNNNNNN</t7><p7>TAGAGCATACGGCAGAAGACGAAC</p7> -5' </pre> 8 cycles. ### Step 3 — Read 2: PLP / transcript sequence (top strand as template) <pre class="seq"> 5'- <p5>AATGATACGGCGACCACCGAGATCTACAC</p5><s5>TCTTTCCCTACACGACGCTCTTCCGATCT</s5><sbc>NNNNNNNNNNNNNNNN</sbc><umi>NNNNNNNNNNNN</umi>-<probe>PLP</probe>-<s7>AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC</s7><t7>NNNNNNNN</t7><p7>ATCTCGTATGCCGTCTTCTGCTTG</p7> -3' <------<s7>TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG</s7> -5' </pre> 50+ cycles (PLP sequence contains probe barcode used for gene identification). --- ## Key Points - **Read 1** (28 cycles): 16 bp spatial barcode + 12 bp UMI. - **Read 2** (50+ cycles): PLP including probe barcode — Space Ranger matches this to the WT Panel probe list. - The WT Panel covers ~18,000 human or mouse protein-coding genes. - CytAssist enables standard glass-slide histology before Visium capture — tissue sections can be H&E or IF stained and imaged before probe capture. - Compatible with **FFPE**, **fresh-frozen**, and **fixed-frozen** tissues.